WormMine: Gene WBGene00006805

• WormBase Gene ID: WBGene00006805
• Gene Name: unc-73
• Sequence Name: F55C7.7
• Brief Description: unc-73 encodes a guanine nucleotide exchange factor (GNEF) similar to the Trio protein; UNC-73 is required for vulval morphogenesis, for the migration of QL, QR, CAN, and hypodermal P cells, the commissure outgrowth of D type motoneurons, and amphid axon outgrowth; UNC-73 has GNEF activity for both CED-10 and MIG-2 in vitro; the requirement for UNC-73 in P cell migration can be suppressed by transgenic overexpression of rho-1; UNC-73 activates several small GTPases: RHO-1 in P cell migration, and both CED-10 and MIG-2 in vulval morphogenesis, P cell migration, and axon outgrowth.
• Organism: Caenorhabditis elegans
• Automated Description: Enables guanyl-nucleotide exchange factor activity and small GTPase binding activity. Involved in several processes, including generation of neurons; modulation of chemical synaptic transmission; and regulation of neuron projection development. Located in axon; cytoplasm; and muscle cell projection. Expressed in several structures, including egg-laying apparatus; hermaphrodite gonad; lumbar ganglion; neurons; and tail hypodermis. Used to study epilepsy. Human ortholog(s) of this gene implicated in artery disease (multiple); autosomal dominant intellectual developmental disorder 44; and cerebral infarction. Is an ortholog of human KALRN (kalirin RhoGEF kinase) and TRIO (trio Rho guanine nucleotide exchange factor).
• Biotype: SO:0001217
• Genetic Position: I :-1.87882 ±0.020891
• Length (nt): 32440

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00006805

Genomics

10 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F55C7.7a.1	F55C7.7a.1	7627	I: 3999300-4031739
Transcript:F55C7.7f.1	F55C7.7f.1	2955	I: 3999300-4017476
Transcript:F55C7.7c.1	F55C7.7c.1	3155	I: 3999306-4020617
Transcript:F55C7.7h.1	F55C7.7h.1	2772	I: 3999348-4011578
Transcript:F55C7.7i.1	F55C7.7i.1	7361	I: 4001612-4031627
Transcript:F55C7.7i.2	F55C7.7i.2	7400	I: 4001616-4031627
Transcript:F55C7.7d.1	F55C7.7d.1	2519	I: 4001618-4008336
Transcript:F55C7.7e.1	F55C7.7e.1	2622	I: 4001618-4011585
Transcript:F55C7.7g.1	F55C7.7g.1	3003	I: 4001618-4020664
Transcript:F55C7.7b.1	F55C7.7b.1	5504	I: 4015176-4031627

Other

9 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F55C7.7a	F55C7.7a	7467	I: 3999348-3999523
CDS:F55C7.7c	F55C7.7c	2787	I: 3999348-3999523
CDS:F55C7.7f	F55C7.7f	2904	I: 3999348-3999523
CDS:F55C7.7d	F55C7.7d	1659	I: 4002331-4002508
CDS:F55C7.7e	F55C7.7e	1902	I: 4002331-4002508
CDS:F55C7.7g	F55C7.7g	1917	I: 4002331-4002508
CDS:F55C7.7b	F55C7.7b	4917	I: 4015763-4015776
CDS:F55C7.7h	F55C7.7h	2772	I: 3999348-3999523
CDS:F55C7.7i	F55C7.7i	6423	I: 4002593-4002832

61 RNAi Result

• WBRNAi00107807
• WBRNAi00107808
• WBRNAi00107805
• WBRNAi00107806
• WBRNAi00107789
• WBRNAi00107788
• WBRNAi00064015
• WBRNAi00089747
• WBRNAi00066043
• WBRNAi00068175
• WBRNAi00002245
• WBRNAi00048479
• WBRNAi00003786
• WBRNAi00025667
• WBRNAi00025669
• WBRNAi00109243
• WBRNAi00080571
• WBRNAi00025670
• WBRNAi00116158
• WBRNAi00077379
• WBRNAi00025668
• WBRNAi00099886
• WBRNAi00064639
• WBRNAi00100427
• WBRNAi00003784
• WBRNAi00109631
• WBRNAi00084986
• WBRNAi00032869
• WBRNAi00100801
• WBRNAi00099684

455 Allele

• gk962706
• gk963902
• gk964159
• otn9298
• rh40
• rh108
• WBVar02066331
• WBVar01431275
• WBVar01431278
• WBVar01694748
• gk730627
• WBVar01655160
• WBVar01932242
• WBVar01932240
• cxTi10197
• e936
• h142
• WBVar02016321
• ok936
• WBVar01411458
• WBVar01411460
• WBVar01411459
• az100
• gk961575
• WBVar01411461
• az63
• WBVar01411463
• WBVar00043101
• WBVar00043111
• WBVar00152693

1 Chromosome

• WormBase ID: I
• Organism: Caenorhabditis elegans
• Length (nt): 15072434

1 Chromosome Location

• Feature . Primary Identifier: WBGene00006805
• Start: 3999300
• End: 4031739
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrI_3996403..3999299
• Length (nt): 2897
• Chromosome Location: I: 3996403-3999299
• Organism: Caenorhabditis elegans

148 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Genes significantly enriched in NSM neurons (isolated by FACS) versus the reference, according to RNAseq analysis towards total RNA.	Gene expression quantification and differential expression was analyzed using cufflinks v2.2.1. Enriched contains only genes significantly enriched (differentially expressed >= 2.4 fold in total RNA or >= 3.2 fold in DSN treated total RNA) in the NSM neurons versus the reference.	WBPaper00045974:NSM_enriched_totalRNA_RNAseq
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at old adults stage (214 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_aging
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_developing
	Genes with expression level regulated by genotype (N2 vs CB4856) at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_regulated_developing
	Transcripts expressed in vulva.	FPKM >= 1.	WBPaper00064122:vulva_transcriptome
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure.	Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2).	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:S.aureus-4h_upregulated_N2
	Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage.	DESeq2 version 1.22.2, p < 0.05	WBPaper00064716:paraquat_downregulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome
	Proteins that showed significantly decreased expression after 1-day-old wild type adults were exposed to cisplatin (300ug per mL) for 6 hours.	The differential expression analysis was performed in R. Differentially expressed proteins were identified by using a two-sided t-test on log-transformed data.	WBPaper00065373:Cisplatin_downregulated_WT
	Proteins that showed significantly decreased expression in 1-day-old sek-1(km4) adults comparing to in wild type animals, both with 6 hours of cisplatin treatment.	The differential expression analysis was performed in R. Differentially expressed proteins were identified by using a two-sided t-test on log-transformed data.	WBPaper00065373:sek-1(km4)_downregulated_cisplatin
	Transcripts that were regulated by both set-6(ok2195) and baz-2(tm0235) at 2-day post L4 adult hermaphrodite stage.	N.A.	WBPaper00059356:set-6(ok2195)_baz-2(tm0235)_regulated
	Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals.	DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2.	WBPaper00062159:hda-2(ok1479)_upregulated
	Transcripts that showed significantly decreased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin-Allantoin_downregulated
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(+), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(+)_vs_control_day2-adult
	Transcripts of coding genes that showed significantly increased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_enriched_coding-RNA

19 Expression Patterns

• Primary Identifier: Expr6201
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC14640
• Reporter Gene: [unc-73::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GACACCGATATGGTTTTTGACAT] 3' and primer B 5' [ATGGAGGAATTTTATGCGAATTT] 3'.
• Pattern: Adult Expression: pharynx; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in body ; Larval Expression: pharynx; body wall muscle; seam cells; Nervous System; nerve ring; head neurons; tail neurons; unidentified cells in head; unidentified cells in body

• Primary Identifier: Expr6202
• Remark: Strain: BC13403
• Reporter Gene: [unc-73::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GACACCGATATGGTTTTTGACAT] 3' and primer B 5' [ATGGAGGAATTTTATGCGAATTT] 3'.
• Pattern: Adult Expression: body wall muscle; seam cells; Nervous System; head neurons; tail neurons; Larval Expression: body wall muscle; seam cells; Nervous System; head neurons; tail neurons

• Primary Identifier: Expr6203
• Remark: Also expressed in (comments from author) : Embryo incomplete. To be updated. Adults occassionally have same GFP pattern as larvae. Strain: BC11480
• Reporter Gene: [unc-73::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GACACCGATATGGTTTTTGACAT] 3' and primer B 5' [ATGGAGGAATTTTATGCGAATTT] 3'.
• Pattern: Adult Expression: pharynx; intestine; unidentified cells; Larval Expression: Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons

• Primary Identifier: Expr1438
• Remark: All of the reporter constructs produced the same cell-specific expression pattern as transgenes.
• Pattern: The reporter transgenes express ubiquitously in the early embryo starting at about the 100 cell stage during gastrulation. In late embryogenesis and posthatching, expression is more limited. Strongest expression is observed in migrating cells and growing neurons as these cells undergo movements on the epidermis. At hatching, the reporters express in many neurons throughout the animal, in several cells of the pharynx including some pharyngeal neurons, in the elongated processes of the excretory cells, in the amphid and phasmid sheath and socket cells, in the tail hypodermis, and at later stages in intestine, muscles, vulva, and somatic gonad including the gonad sheath and hermaphrodite distal tip cells. The neurons expressing unc-73 include the PLM, ALM, PDE, HSN, CAN, PHC, and PVN neurons and the ventral cord motorneurons. Expression in the HSNs is absent in early larval stages, but begins late in the second larval stage (L2), precisely when axon outgrowth is initiated from the HSN cell bodies. The Q neuroblasts, Pn neuroectoblasts, sex myoblasts (SMs), and canal associated neurons (CANs) express unc-73 reporters. The left and right Q cells begin to express the GFP reporter as they initiate their migrations along the longitudinal axis of the epidermis during the early first larval (L1) stage, and expression in these cells continues beyond the completion of their first division. The unc-73 reporters express in the Pn cells just before this second phase of movemen. The distal tip cells also express the unc-73/reporters during their migration.

• Primary Identifier: Expr3776
• Pattern: In contrast, D1 and D2 were very strongly expressed in the muscles of the pharynx and vulva and in both the cell bodies and axons of a very restricted set of neurons. These included the hermaphrodite-specific neurons (HSNs), about four unidentified neurons with cell bodies in either the ventral or retrovesicular ganglion near the terminal bulb of the pharynx, and about six neurons with cell bodies in the lumbar ganglion in the tail, including PVQL and PVQR, as distinguished by their axonal patterning. A small number of axons were present in the nerve ring and the ventral cord. The lateral processes of ALNL and ALNR were also visible. D1 and D2 also exhibited sporadic and weak fluorescence in body wall and intestinal muscles. Isoform E was strongly expressed in the nervous system and was detected in the cell bodies and axons of most, if not all neurons, including those in the pharynx, and at least some of the neuron-associated sheath and/or socket cells. Isoform E was also observed in the excretory canals and the somatic gonad, including the spermatheca, gonadal sheath, and distal tip cells. Isoform B was expressed most strongly in the axons of neurons, particularly in the nerve ring and the ventral nerve cord. This pattern of expression was very similar to the staining pattern observed with UNC-73 B antibodies. UNC-73 B was also found more sporadically and at a lower level in anal depressor muscle, distal tip, P, seam, and developing vulva cells. Although C1 and C2/F were also expressed in axons, their expression was restricted to fewer neurons. Many process bundles within the body of the animal and neurons within the pharynx were positive for C1 and C2/F, but few axons were visible in the nerve ring. Along with the neuronal expression, C1 and C2/F were also expressed in neuron-associated socket and/or sheath cells and the neuroendocrine uv1 cells. A low level of expression was sporadically observed in body wall muscles.
• Subcellular Localization: Expressed in axons and cell bodies.

• Primary Identifier: Expr8752
• Remark: No detailed description on expression pattern in other tissue or life stages.. Picture: N.A.
• Pattern: Not expressed in gonad.

• Primary Identifier: Expr8751
• Remark: No detailed description on expression pattern in other tissue or life stages.. Picture: Fig 1K, Fig 3.
• Pattern: Expressed in somatic primodium at L2 stage. Expressed in VU/DU, AC and DTC at L3 stage. Expressed in uterine epithelium and spermathecal epithelium at L4 stage.

• Primary Identifier: Expr8754
• Remark: No detailed description on expression pattern in other tissue or life stages.. Picture: N.A.
• Pattern: Expressed in spermathecal epithelium at L4 stage.

• Primary Identifier: Expr8753
• Remark: No detailed description on expression pattern in other tissue or life stages.. Picture: N.A.
• Pattern: Expressed in uterine epithelium and spermathecal epithelium at L4 stage.

• Primary Identifier: Expr2036039
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr8541
• Remark: Picture: Fig. 3E.
• Subcellular Localization: UNC-73B::CFP localizes diffusely throughout the cytoplasm, but is obviously and consistently enriched at the muscle arm termini, where it co-localizes with UNC-40::YFP.

• Primary Identifier: Expr1032873
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr1152269
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Chronogram258
• Remark: Original chronogram file: chronogram.1284.xml
• Reporter Gene: [F55C7.7:gfp] transcriptional fusion.

• Primary Identifier: Expr1024579
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Chronogram938
• Remark: Original chronogram file: chronogram.1986.xml
• Reporter Gene: [F55C7.7:gfp] transcriptional fusion.

• Primary Identifier: Expr2017903
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Chronogram1958
• Remark: Original chronogram file: chronogram.876.xml
• Reporter Gene: [F55C7.7:gfp] transcriptional fusion.

• Primary Identifier: Chronogram1266
• Remark: Original chronogram file: chronogram.2389.xml
• Reporter Gene: [F55C7.7:gfp] transcriptional fusion.

38 GO Annotation

17 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00006805
• Start: 3999300
• End: 4031739
• Strand: -1

38 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 32440

1 Sequence Ontology Term