WormMine: Gene WBGene00023713

• WormBase Gene ID: WBGene00023713
• Gene Name: Cbr-gld-1
• Sequence Name: CBG00303
• Brief Description: Cbr-gld-1 encodes an RNA-binding protein that is a member of the STAR (Signal Transduction and Activation of RNA metabolism) family of translational regulators; in contrast to its role in C. elegans, Cbr-gld-1 functions in the hermaphrodite germ line to promote oogenesis (as opposed to spermatogenesis); expression of Cbr-gld-1 in C. elegans gld-1 mutant animals can, however, restore XX spermatogenesis and normal oogenesis, indicating that the distinct functions of C. briggsae and C. elegans GLD-1 is due to species-specific context; Cbr-GLD-1 likely regulates oogenesis through negative translational regulation of Cbr-puf-8, a sperm-promoting gene, as Cbr-GLD-1 binds a synthetic Cbr-puf-8 3'UTR in vitro and Cbr-puf-8(RNAi) suppresses the sperm production of Cbr-gld-1(RNAi).
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable RNA binding activity. Expressed in germ line. Is an ortholog of C. elegans gld-1. In C. elegans, gld-1 is involved in several processes, including negative regulation of nitrogen compound metabolic process; oocyte fate determination; and positive regulation of reproductive process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG00303.1	CBG00303.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG00303	CBG00303		[unknown]

0 RNAi Result

4 Allele

• WBVar00141117
• nm41
• nm68

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_upregulated

2 Expression Patterns

• Primary Identifier: Expr12356
• Pattern: A highly conserved GLD-1 ortholog is present in C. briggsae and has a germline expression pattern essentially identical to that of C. elegans.

• Primary Identifier: Expr1061643
• Remark: Cbr-gld-1, CATCATCAATGGAACCTATCGTCCAATGAAATCTCCAAATCCAGCTCGCATGATGACTGC, WBGene00023713
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term