WormMine: Gene WBGene00023892

• WormBase Gene ID: WBGene00023892
• Gene Name: Cbr-pyr-1
• Sequence Name: CBG00515
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable several functions, including ATP binding activity; aspartate carbamoyltransferase activity; and carbamoyl-phosphate synthase (glutamine-hydrolyzing) activity. Predicted to be involved in 'de novo' pyrimidine nucleobase biosynthetic process and glutamine metabolic process. Is an ortholog of C. elegans pyr-1. In C. elegans, pyr-1 is involved in several processes, including nematode pharyngeal gland morphogenesis; nematode pharynx development; and pyrimidine nucleobase biosynthetic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG00515.1	CBG00515.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG00515	CBG00515		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	C.briggsae proteins that showed significantly decreased at L1 larva stage than in emrbyo.	Benjamin and Hochberg corrected p-value < 0.05.	WBPaper00051425:CB_L1_vs_embryo_downregulated

1 Expression Patterns

• Primary Identifier: Expr1063913
• Remark: Cbr-pyr-1, TGCCGAGGATTATGAGAAGGTCAAGGGAAGCTACATTATCAACGCGAAGCTGCTCAACGA, WBGene00023892
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

10 GO Annotation

0 Homologues

0 Locations

10 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term