WormMine: Gene WBGene00024209

• WormBase Gene ID: WBGene00024209
• Gene Name: Cbr-srb-6
• Sequence Name: CBG00892
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable transmembrane signaling receptor activity. Predicted to be involved in sensory perception of chemical stimulus. Predicted to be located in membrane. Is an ortholog of C. elegans srb-6. In C. elegans, srb-6 is involved in defense response to Gram-positive bacterium and detection of chemical stimulus.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG00892.1	CBG00892.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG00892	CBG00892		[unknown]

0 RNAi Result

1 Allele

• WBVar00135632

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1060696
• Remark: CBG00892, CTTCTGAGCGCGAATTTGATCGATTTGGTGGCCAATTTGGCTATGGAAAAGATCAATACT, WBGene00024209
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term