WormMine: Gene WBGene00024619

• WormBase Gene ID: WBGene00024619
• Gene Name: Cbr-lipl-5
• Sequence Name: CBG01370
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable hydrolase activity, acting on ester bonds. Predicted to be involved in lipid metabolic process. Is an ortholog of C. elegans lipl-5. In C. elegans, lipl-5 is involved in defense response to Gram-negative bacterium; lipid homeostasis; and triglyceride catabolic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG01370.1	CBG01370.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG01370	CBG01370		[unknown]

0 RNAi Result

4 Allele

• WBVar00034404
• WBVar00034399
• WBVar00034389
• WBVar00034394

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_upregulated

1 Expression Patterns

• Primary Identifier: Expr1067736
• Remark: CBG01370, GACTACGTGCGCCACAGGACATTTATCATCCAGCAGTGGAGCTTTGTACAAATGATTATT, WBGene00024619
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term