WormMine: Gene WBGene00024751

• WormBase Gene ID: WBGene00024751
• Gene Name: Cbr-pxn-1
• Sequence Name: CBG01526
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable heme binding activity and peroxidase activity. Predicted to be involved in response to oxidative stress. Is an ortholog of C. elegans pxn-1. In C. elegans, pxn-1 is involved in muscle attachment and positive regulation of axon guidance.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG01526.1	CBG01526.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG01526	CBG01526		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1051960
• Remark: Cbr-pxn-1, GACTTTTGCATGCATCATTGGAGAGCAGTTCAGGAAGATGAGAGATGGAGATAGATTCTG, WBGene00024751
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term