WormMine: Gene WBGene00024777

• WormBase Gene ID: WBGene00024777
• Gene Name: Cbr-pmk-2
• Sequence Name: CBG01554
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity and MAP kinase activity. Is an ortholog of C. elegans pmk-2. In C. elegans, pmk-2 is involved in intracellular signal transduction and response to osmotic stress.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG01554.1	CBG01554.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG01554	CBG01554		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1061945
• Remark: Cbr-pmk-2, AATTTCAGTTTCCAGTGCTCTTCGTCATGACTACCTTCGAGAGTATTCCGTTCCAAATGA, WBGene00024777
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term