WormMine: Gene WBGene00024894

• WormBase Gene ID: WBGene00024894
• Gene Name: Cbr-gbb-2
• Sequence Name: CBG01699
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable G protein-coupled GABA receptor activity. Predicted to be involved in G protein-coupled receptor signaling pathway. Predicted to be located in membrane. Is an ortholog of C. elegans gbb-2. In C. elegans, gbb-2 is involved in G protein-coupled receptor signaling pathway; negative regulation of cholinergic synaptic transmission; and response to xenobiotic stimulus.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

6 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG01699a.1	CBG01699a.1		[unknown]
Transcript:CBG01699a.3	CBG01699a.3		[unknown]
Transcript:CBG01699a.2	CBG01699a.2		[unknown]
Transcript:CBG01699a.5	CBG01699a.5		[unknown]
Transcript:CBG01699a.4	CBG01699a.4		[unknown]
Transcript:CBG01699b.1	CBG01699b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG01699a	CBG01699a		[unknown]
CDS:CBG01699b	CBG01699b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1061102
• Remark: CBG01699, TCCCAGAAGTGGAAAAGTGTTATTCATCGAATTCAGGAGTCTTTCAAGCAGTTCTTTATG, WBGene00024894
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term