WormMine: Gene WBGene00025073

• WormBase Gene ID: WBGene00025073
• Gene Name: Cbr-lec-8
• Sequence Name: CBG01904
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable carbohydrate binding activity. Is an ortholog of C. elegans lec-8. In C. elegans, lec-8 is involved in response to toxic substance.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG01904.1	CBG01904.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG01904	CBG01904		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_upregulated

1 Expression Patterns

• Primary Identifier: Expr1060545
• Remark: Cbr-lec-8, GGTGCCTATGGAACTGAGACTTATGTGGCTCCAGTCTTCCAAGAGACTCACTCCTACAAC, WBGene00025073
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term