WormMine: Gene WBGene00025132

• WormBase Gene ID: WBGene00025132
• Gene Name: CBG01975
• Sequence Name: CBG01975
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable glutamate synthase (NADH) activity and small molecule binding activity. Predicted to be involved in glutamate biosynthetic process. Is an ortholog of C. elegans W07E11.1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG01975a.1	CBG01975a.1		[unknown]
Transcript:CBG01975b.1	CBG01975b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG01975a	CBG01975a		[unknown]
CDS:CBG01975b	CBG01975b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	C.briggsae proteins that showed significantly decreased at L1 larva stage than in emrbyo.	Benjamin and Hochberg corrected p-value < 0.05.	WBPaper00051425:CB_L1_vs_embryo_downregulated
	C.briggsae proteins that showed significantly decreased at L4 larva stage than in emrbyo.	Benjamin and Hochberg corrected p-value < 0.05.	WBPaper00051425:CB_L4_vs_embryo_downregulated

1 Expression Patterns

• Primary Identifier: Expr1068072
• Remark: CBG01975, CATCGAGCAGCTCAACTTGAAGACTGACCCAAGATCCAACATTCTCACTCCAAAGGACAA, WBGene00025132
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

10 GO Annotation

0 Homologues

0 Locations

10 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term