WormMine: Gene WBGene00025163

• WormBase Gene ID: WBGene00025163
• Gene Name: Cbr-gbb-1
• Sequence Name: CBG02016
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable G protein-coupled GABA receptor activity. Predicted to be involved in G protein-coupled receptor signaling pathway. Predicted to be located in membrane. Is an ortholog of C. elegans gbb-1. In C. elegans, gbb-1 is involved in G protein-coupled receptor signaling pathway; negative regulation of cholinergic synaptic transmission; and response to xenobiotic stimulus.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG02016.1	CBG02016.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG02016	CBG02016		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1066935
• Remark: CBG02016, TTCTAATCTGCACATACATCTCTGTGGGATTAATATATGGTCCAAAGATCCGTCATATAA, WBGene00025163
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term