WormMine: Gene WBGene00025231

• WormBase Gene ID: WBGene00025231
• Gene Name: Cbr-gcy-31
• Sequence Name: CBG02110
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable guanylate cyclase activity and heme binding activity. Predicted to be involved in cGMP biosynthetic process and intracellular signal transduction. Is an ortholog of C. elegans gcy-31. In C. elegans, gcy-31 is involved in response to oxygen levels.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG02110.1	CBG02110.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG02110	CBG02110		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1064430
• Remark: Cbr-gcy-31, AAATGGTCAACATGAATGCAAAAGTTCCACGTATTGATATCCGCGCCGGTGTTCATTCCG, WBGene00025231
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term