WormMine: Gene WBGene00025427

• WormBase Gene ID: WBGene00025427
• Gene Name: Cbr-frpr-4
• Sequence Name: CBG02360
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable G protein-coupled peptide receptor activity. Predicted to be involved in G protein-coupled receptor signaling pathway. Predicted to be located in membrane. Is an ortholog of C. elegans frpr-4.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG02360a.1	CBG02360a.1		[unknown]
Transcript:CBG02360b.1	CBG02360b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG02360b	CBG02360b		[unknown]
CDS:CBG02360a	CBG02360a		[unknown]

0 RNAi Result

4 Allele

• WBVar00107303
• WBVar00107302
• WBVar00107301
• WBVar00107300

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1065959
• Remark: CBG02360, TTCTTCGGATTTTGTCATTTCTTTTCGATGGCCTTAAAGCTTGCAGAAAGTTTTGCAGGC, WBGene00025427
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term