WormMine: Gene WBGene00025623

• WormBase Gene ID: WBGene00025623
• Gene Name: Cbr-tat-4
• Sequence Name: CBG02601
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP hydrolysis activity; ATPase-coupled intramembrane lipid transporter activity; and small molecule binding activity. Predicted to be involved in phospholipid transport. Predicted to be located in membrane. Is an ortholog of C. elegans tat-4. In C. elegans, tat-4 is involved in sterol metabolic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG02601.1	CBG02601.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG02601	CBG02601		[unknown]

0 RNAi Result

3 Allele

• WBVar00107550
• WBVar00107549
• WBVar00107548

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1055981
• Remark: Cbr-tat-4.1, CAATTGCAAGATTCAAATTTCTGTCTAGACTGTTATTGGTTCATGGACACTGGAGCTACT, WBGene00025623
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

8 GO Annotation

0 Homologues

0 Locations

8 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term