WormMine: Gene WBGene00025722

• WormBase Gene ID: WBGene00025722
• Gene Name: CBG02717
• Sequence Name: CBG02717
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable chitin binding activity. Predicted to be involved in carbohydrate metabolic process. Is an ortholog of C. elegans T19H5.6; R09D1.14; and chil-25.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG02717.1	CBG02717.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG02717	CBG02717		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_upregulated
Virus infection: Santeuil infected at L3 larva stage for 12 hours.	Transcripts that showed signicantly increased expression after Santeuil virus infection to C. briggsae strain JU1264.	edgeR, FDR < 0.05.	WBPaper00051137:Santeuil-virus_upregulated_JU1264

1 Expression Patterns

• Primary Identifier: Expr1058987
• Remark: CBG02717, TTTATCAGAGAGGAAAACTTAGGAGGATTATGGATCCGTTTTATGGATATGGATGACGAT, WBGene00025722
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term