WormMine: Gene WBGene00025811

• WormBase Gene ID: WBGene00025811
• Gene Name: Cbr-nep-1
• Sequence Name: CBG02837
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable metalloendopeptidase activity. Predicted to be involved in proteolysis. Is an ortholog of C. elegans nep-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG02837.1	CBG02837.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG02837	CBG02837		[unknown]

0 RNAi Result

12 Allele

• WBVar00107767
• WBVar00107766
• WBVar00107765
• WBVar00107764
• WBVar00107763
• WBVar00107762
• WBVar00107761
• WBVar00107760
• WBVar00107759
• WBVar00107758
• WBVar00107757
• WBVar00107768

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_upregulated

1 Expression Patterns

• Primary Identifier: Expr1057948
• Remark: Cbr-nep-1, GTAAACACCGTGCTTTCAAACCAGCCAGAATTTGCCGAAGCCTTCAAATGCCCAGCCGGC, WBGene00025811
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term