WormMine: Gene WBGene00025831

• WormBase Gene ID: WBGene00025831
• Gene Name: CBG02861
• Sequence Name: CBG02861
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable flavin adenine dinucleotide binding activity and oxidoreductase activity, acting on the CH-CH group of donors. Is an ortholog of C. elegans F54D5.7.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG02861b.1	CBG02861b.1		[unknown]
Transcript:CBG02861a.1	CBG02861a.1		[unknown]
Transcript:CBG02861a.2	CBG02861a.2		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG02861b	CBG02861b		[unknown]
CDS:CBG02861a	CBG02861a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly decreased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_downregulated

1 Expression Patterns

• Primary Identifier: Expr1054377
• Remark: CBG02861, TGGTCGTTTGGGCCAGAAGTTCTCGACATGGAAACAAGATCAAGGGATTTATTCTGGAAA, WBGene00025831
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term