WormMine: Gene WBGene00025946

• WormBase Gene ID: WBGene00025946
• Gene Name: Cbr-cyn-4
• Sequence Name: CBG02999
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable peptidyl-prolyl cis-trans isomerase activity and ubiquitin-protein transferase activity. Predicted to be involved in protein ubiquitination. Is an ortholog of C. elegans cyn-4. In C. elegans, cyn-4 is involved in feminization of hermaphroditic germ-line.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG02999.1	CBG02999.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG02999	CBG02999		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1055154
• Remark: Cbr-cyn-4, AGTACATGAAGTCGACCGCATCTGCCAACAAACGACAAGGACAAATGGAAGATGTGCCCT, WBGene00025946
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term