WormMine: Gene WBGene00025953

• WormBase Gene ID: WBGene00025953
• Gene Name: Cbr-mix-1
• Sequence Name: CBG03006
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity and ATP hydrolysis activity. Predicted to be involved in chromosome organization. Predicted to be located in chromosome. Is an ortholog of C. elegans mix-1. In C. elegans, mix-1 is involved in several processes, including dosage compensation by hypoactivation of X chromosome; mitotic chromosome condensation; and positive regulation of nematode male tail tip morphogenesis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG03006.1	CBG03006.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG03006	CBG03006		[unknown]

0 RNAi Result

3 Allele

• WBVar00107972
• WBVar00107971
• WBVar00107970

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1055260
• Remark: Cbr-mix-1, TTCATCATTGTATCCTTGAAACAAGGAATGTTCTCCAACGCCGATGCTCTGTTCCAAACT, WBGene00025953
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term