WormMine: Gene WBGene00025978

• WormBase Gene ID: WBGene00025978
• Gene Name: Cbr-ptb-1
• Sequence Name: CBG03033
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable RNA binding activity. Predicted to be involved in mRNA processing. Predicted to be located in nucleus. Is an ortholog of C. elegans ptb-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG03033b.1	CBG03033b.1		[unknown]
Transcript:CBG03033c.1	CBG03033c.1		[unknown]
Transcript:CBG03033a.1	CBG03033a.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG03033c	CBG03033c		[unknown]
CDS:CBG03033a	CBG03033a		[unknown]
CDS:CBG03033b	CBG03033b		[unknown]

0 RNAi Result

4 Allele

• WBVar00141832
• WBVar00141833
• WBVar00141834
• WBVar00141835

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1060242
• Remark: Cbr-ptb-1, ACAATCATAAGCTAGCTGAAAATGCTCATCTGCGTGTTTCCTTCTCCAAATCCGGCATCT, WBGene00025978
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term