WormMine: Gene WBGene00026143

• WormBase Gene ID: WBGene00026143
• Gene Name: Cbr-gcs-1
• Sequence Name: CBG03249
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable glutamate-cysteine ligase activity. Predicted to be involved in glutathione biosynthetic process. Is an ortholog of C. elegans gcs-1. In C. elegans, gcs-1 is involved in glutathione biosynthetic process; response to arsenic-containing substance; and response to stress.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG03249.1	CBG03249.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG03249	CBG03249		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1069132
• Remark: Cbr-gcs-1, ATTTGTTCAATCTCACCCGGCTTACAAACATGATAGTGATGTTAACGACACCATTGTTTA, WBGene00026143
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term