WormMine: Gene WBGene00026196

• WormBase Gene ID: WBGene00026196
• Gene Name: CBG03314
• Sequence Name: CBG03314
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity and kinase activity. Is an ortholog of C. elegans F19B6.1. In C. elegans, F19B6.1 is involved in embryo development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG03314.1	CBG03314.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG03314	CBG03314		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1068330
• Remark: CBG03314, TTACTCTGATCGATTGATGCGTATCCTCATCGAAGAATGCATGAATCATATGCCATACAA, WBGene00026196
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term