WormMine: Gene WBGene00026198

• WormBase Gene ID: WBGene00026198
• Gene Name: Cbr-sec-24.2
• Sequence Name: CBG03317
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable zinc ion binding activity. Predicted to be involved in endoplasmic reticulum to Golgi vesicle-mediated transport and intracellular protein transport. Predicted to be part of COPII vesicle coat. Is an ortholog of C. elegans sec-24.2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG03317.1	CBG03317.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG03317	CBG03317		[unknown]

0 RNAi Result

1 Allele

• WBVar00141983

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1064549
• Remark: Cbr-sec-24.2, CACTCACAAGATACTTGACTAGAAAACTTGGATTCGAAGCTGTCTTACGCATCCGCACAT, WBGene00026198
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term