WormMine: Gene WBGene00026399

• WormBase Gene ID: WBGene00026399
• Gene Name: CBG03556
• Sequence Name: CBG03556
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable metalloendopeptidase activity. Predicted to be involved in cell adhesion and proteolysis. Predicted to be located in membrane. Is an ortholog of C. elegans Y43F4A.1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG03556b.1	CBG03556b.1		[unknown]
Transcript:CBG03556a.1	CBG03556a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG03556a	CBG03556a		[unknown]
CDS:CBG03556b	CBG03556b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1052388
• Remark: CBG03556, AAAAGTGGTTGATGGTTGGCTGAGAGAAGGATCTTTAATCTGCCCAAAGTGCTCGGATTA, WBGene00026399
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term