WormMine: Gene WBGene00026641

• WormBase Gene ID: WBGene00026641
• Gene Name: Cbr-scpl-1
• Sequence Name: CBG03870
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable phosphatase activity. Is an ortholog of C. elegans scpl-1. In C. elegans, scpl-1 is involved in regulation of egg-laying behavior.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG03870c.1	CBG03870c.1		[unknown]
Transcript:CBG03870b.1	CBG03870b.1		[unknown]
Transcript:CBG03870a.1	CBG03870a.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG03870b	CBG03870b		[unknown]
CDS:CBG03870c	CBG03870c		[unknown]
CDS:CBG03870a	CBG03870a		[unknown]

0 RNAi Result

3 Allele

• WBVar00108791
• WBVar00108790
• WBVar00017759

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1068071
• Remark: Cbr-scpl-1, GTTTGATGATCCAGCCGATACGGAGTTATTAGACATTCTGCCCACTTTGGAGCATCTGAA, WBGene00026641
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term