WormMine: Gene WBGene00026668

• WormBase Gene ID: WBGene00026668
• Gene Name: Cbr-rpl-7
• Sequence Name: CBG03905
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be a structural constituent of ribosome. Predicted to be involved in maturation of LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA). Predicted to be part of cytosolic large ribosomal subunit. Is an ortholog of C. elegans rpl-7.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG03905.1	CBG03905.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG03905	CBG03905		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	C.briggsae proteins that showed significantly increased at L4 larva stage than in emrbyo.	Benjamin and Hochberg corrected p-value < 0.05.	WBPaper00051425:CB_L4_vs_embryo_upregulated

1 Expression Patterns

• Primary Identifier: Expr1056219
• Remark: Cbr-rpl-7, GTTGAGGGAGGAGACTTCGGAAACAGAGAAGATCAACTCAACAACCTTCTCCGAAGAATG, WBGene00026668
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term