WormMine: Gene WBGene00026676

• WormBase Gene ID: WBGene00026676
• Gene Name: CBG03913
• Sequence Name: CBG03913
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in anaphase-promoting complex-dependent catabolic process. Predicted to be part of anaphase-promoting complex. Is an ortholog of C. elegans Y48G1C.12.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG03913.1	CBG03913.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG03913	CBG03913		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1063351
• Remark: CBG03913, GCCATCGATATTCGTGACAAAATGGAACGACCGCAACGGGTTTTCTGGATTCAAATTCAG, WBGene00026676
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term