WormMine: Gene WBGene00026714

• WormBase Gene ID: WBGene00026714
• Gene Name: Cbr-cpg-1
• Sequence Name: CBG03957
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable chitin binding activity. Predicted to be located in extracellular region. Is an ortholog of C. elegans cpg-1. In C. elegans, cpg-1 is involved in several processes, including eggshell formation; mitotic cytokinesis; and regulation of cytokinesis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG03957a.1	CBG03957a.1		[unknown]
Transcript:CBG03957b.1	CBG03957b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG03957b	CBG03957b		[unknown]
CDS:CBG03957a	CBG03957a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in Cbr-htz-1(gu167) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-htz-1(gu167)_upregulated
	Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_upregulated

1 Expression Patterns

• Primary Identifier: Expr1061653
• Remark: Cbr-cpg-1, AACTACAACTGTCGGATACGCTCCAGAAGTCATTGAGGAGACTACTACATCTGAATACGT, WBGene00026714
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term