WormMine: Gene WBGene00026818

• WormBase Gene ID: WBGene00026818
• Gene Name: Cbr-tba-5
• Sequence Name: CBG04075
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable GTP binding activity. Predicted to be a structural constituent of cytoskeleton. Predicted to be involved in microtubule-based process. Predicted to be located in microtubule. Is an ortholog of C. elegans tba-5.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG04075b.1	CBG04075b.1		[unknown]
Transcript:CBG04075a.1	CBG04075a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG04075a	CBG04075a		[unknown]
CDS:CBG04075b	CBG04075b		[unknown]

0 RNAi Result

3 Allele

• WBVar00108985
• WBVar00108984
• WBVar00108983

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1055859
• Remark: Cbr-tba-5, GAAACGGAAAATACATGGCATGTTGTCTTCTTTATCGTGGAGACGTTGTTCCCAAAGACA, WBGene00026818
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term