WormMine: Gene WBGene00026950

• WormBase Gene ID: WBGene00026950
• Gene Name: CBG04232
• Sequence Name: CBG04232
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable creatine kinase activity. Predicted to be involved in phosphocreatine biosynthetic process. Is an ortholog of C. elegans F32B5.1 and W10C8.5.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG04232b.1	CBG04232b.1		[unknown]
Transcript:CBG04232a.1	CBG04232a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG04232b	CBG04232b		[unknown]
CDS:CBG04232a	CBG04232a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1056195
• Remark: CBG04232, GGAGTACCAAGCTGTGAAACAGATGTATGACGGTGTGAAGAAGTTGATTGAGATGGAAGA, WBGene00026950
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term