WormMine: Gene WBGene00026953

• WormBase Gene ID: WBGene00026953
• Gene Name: Cbr-pop-1
• Sequence Name: CBG04236
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in Wnt signaling pathway. Expressed in several structures, including E; Ea; Ep; MSp; and germ line. Is an ortholog of C. elegans pop-1. In C. elegans, pop-1 is involved in several processes, including mesodermal cell fate commitment; regulation of cell division; and regulation of gene expression.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG04236.1	CBG04236.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG04236	CBG04236		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

3 Expression Patterns

• Primary Identifier: Expr12353
• Pattern: Consistent with maternal function, Cb-pop-1 is expressed in the germline as assessed by in situ hybridization.

• Primary Identifier: Expr12354
• Subcellular Localization: Anterior cells in the E and MS lineages showed higher nuclear levels than their posterior sisters. Furthermore, puncta were visible in anterior nuclei, a property of GFP::Ce-POP-1 fusions. Hence, when expressed as GFP fusions, C. elegans and C. briggsae POP-1 appear to undergo similar post-translational processing in C. elegans. The GFP::Cb-POP-1 fusion was under the control of the Ce-med-1 promoter which drives expression in the early EMSlineage (Maduro et al., 2002).

• Primary Identifier: Expr1053004
• Remark: Cbr-pop-1, TCGATCCAACGATCACGCAGCAGACGCAAGAATACATTATGCAGGAATCTGTTTGTACTC, WBGene00026953
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term