WormMine: Gene WBGene00027000

• WormBase Gene ID: WBGene00027000
• Gene Name: Cbr-tsn-1
• Sequence Name: CBG04292
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in regulatory ncRNA-mediated gene silencing. Predicted to be part of RNAi effector complex. Is an ortholog of C. elegans tsn-1. In C. elegans, tsn-1 is involved in miRNA-mediated post-transcriptional gene silencing.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG04292.1	CBG04292.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG04292	CBG04292		[unknown]

0 RNAi Result

15 Allele

• WBVar00109157
• WBVar00109158
• WBVar00109159
• WBVar00109168
• WBVar00109169
• WBVar00109160
• WBVar00109161
• WBVar00109162
• WBVar00109163
• WBVar00109164
• WBVar00109165
• WBVar00109166
• WBVar00109167
• WBVar00109171
• WBVar00109170

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	C.briggsae proteins that showed significantly decreased at L1 larva stage than in emrbyo.	Benjamin and Hochberg corrected p-value < 0.05.	WBPaper00051425:CB_L1_vs_embryo_downregulated

1 Expression Patterns

• Primary Identifier: Expr1069781
• Remark: Cbr-tsn-1, GTACAAGTCTGCCGAGGATAAGGCTCGCAAGAGCAGAAAGAACATCTGGGAGTACGGAGA, WBGene00027000
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term