WormMine: Gene WBGene00027171

• WormBase Gene ID: WBGene00027171
• Gene Name: Cbr-rhgf-1
• Sequence Name: CBG04522
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable guanyl-nucleotide exchange factor activity. Predicted to be located in cytoplasm. Is an ortholog of C. elegans rhgf-1. In C. elegans, rhgf-1 is involved in axon regeneration.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG04522.1	CBG04522.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG04522	CBG04522		[unknown]

0 RNAi Result

16 Allele

• WBVar00136231
• WBVar00136230
• WBVar00136233
• WBVar00136232
• WBVar00136235
• WBVar00136234
• WBVar00136237
• WBVar00136236
• WBVar00136239
• WBVar00136238
• WBVar00136240
• WBVar00136242
• WBVar00136241
• WBVar00136243
• WBVar00003167
• WBVar00010579

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1068449
• Remark: Cbr-rhgf-1, CAAAAACTCACCGAAGTCGAGCCACGAGACCGATCTGTTTCCGAGGAAACCCTAACGGAT, WBGene00027171
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term