WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00027683 Gene Name  Cbr-paqr-2
Sequence Name  ? CBG05167 Organism  Caenorhabditis briggsae
Automated Description  Predicted to be located in membrane. Is an ortholog of C. elegans paqr-2. In C. elegans, paqr-2 is involved in positive regulation of fatty acid oxidation; response to cold; and tail spike morphogenesis. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG05167.1 CBG05167.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG05167 CBG05167   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-paqr-2, GTTCATTTGATGCTCATAATGGGTGCAATGTATATAGGTGGAGCAACTCTCTACGCTACA, WBGene00027683   Expr1058984 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  located_in

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  located_in

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term