WormMine: Gene WBGene00027726

• WormBase Gene ID: WBGene00027726
• Gene Name: CBG05214
• Sequence Name: CBG05214
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable guanyl-nucleotide exchange factor activity. Is an ortholog of C. elegans osg-1. In C. elegans, osg-1 is involved in response to oxidative stress.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG05214a.1	CBG05214a.1		[unknown]
Transcript:CBG05214c.1	CBG05214c.1		[unknown]
Transcript:CBG05214b.1	CBG05214b.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG05214c	CBG05214c		[unknown]
CDS:CBG05214b	CBG05214b		[unknown]
CDS:CBG05214a	CBG05214a		[unknown]

0 RNAi Result

8 Allele

• WBVar00110113
• WBVar00110114
• WBVar00110111
• WBVar00110112
• WBVar00110107
• WBVar00110108
• WBVar00110109
• WBVar00110110

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1061583
• Remark: CBG05214, GGAACGATGTATTTTTATGCTCTCTGATCTTTTACTGGTGACCAGTGTCAAGAAGAAAGC, WBGene00027726
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term