WormMine: Gene WBGene00027741

• WormBase Gene ID: WBGene00027741
• Gene Name: Cbr-snx-17
• Sequence Name: CBG05236
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable phosphatidylinositol binding activity. Predicted to be involved in intracellular protein transport. Is an ortholog of C. elegans snx-17.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG05236.1	CBG05236.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG05236	CBG05236		[unknown]

0 RNAi Result

1 Allele

• WBVar00110171

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1050426
• Remark: CBG05236, TTTTGATGTCACTGCTTCTGCAATCGATTGGCTCTGAGATTCTATATGAGCATAACAATA, WBGene00027741
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term