WormMine: Gene WBGene00027820

• WormBase Gene ID: WBGene00027820
• Gene Name: Cbr-clec-78
• Sequence Name: CBG05359
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable calcium ion binding activity. Is an ortholog of C. elegans clec-78. In C. elegans, clec-78 is involved in defense response to Gram-positive bacterium.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG05359.1	CBG05359.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG05359	CBG05359		[unknown]

0 RNAi Result

47 Allele

• WBVar00136394
• WBVar00136393
• WBVar00136396
• WBVar00136395
• WBVar00136398
• WBVar00136397
• WBVar00110465
• WBVar00110466
• WBVar00110463
• WBVar00110464
• WBVar00110467
• WBVar00110432
• WBVar00110433
• WBVar00110430
• WBVar00110431
• WBVar00110436
• WBVar00110437
• WBVar00110434
• WBVar00110435
• WBVar00110438
• WBVar00110439
• WBVar00110440
• WBVar00110429
• WBVar00110428
• WBVar00110454
• WBVar00110455
• WBVar00110452
• WBVar00110453
• WBVar00110458
• WBVar00110459

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_upregulated

2 Expression Patterns

• Primary Identifier: Expr1059920
• Remark: CBG05362, GAGCCATCGAGCAGCACAAATACGACATCCGCATGCGACAGGCGCAACAACACATGTACC, WBGene00027823
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1066493
• Remark: Cbr-clec-78, CAAACTGCGAGGAAATCACCGACATTTGCTCCACGAATAATCCGTGTCGAAATGGTGCAA, WBGene00027820
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term