WormMine: Gene WBGene00027841

• WormBase Gene ID: WBGene00027841
• Gene Name: Cbr-lin-45
• Sequence Name: CBG05382
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity and protein kinase activity. Predicted to be involved in signal transduction. Is an ortholog of C. elegans lin-45. In C. elegans, lin-45 is involved in several processes, including defense response to Gram-positive bacterium; intracellular signaling cassette; and vulval development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG05382a.1	CBG05382a.1		[unknown]
Transcript:CBG05382b.1	CBG05382b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG05382b	CBG05382b		[unknown]
CDS:CBG05382a	CBG05382a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1058390
• Remark: Cbr-lin-45, GCTATCATCACACAATGGTGCGAGGGATCGAGTCTCTACAGACATATTCATGTTCAAGAA, WBGene00027841
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term