WormMine: Gene WBGene00027908

• WormBase Gene ID: WBGene00027908
• Gene Name: Cbr-smg-3
• Sequence Name: CBG05463
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable RNA binding activity. Predicted to be involved in nuclear-transcribed mRNA catabolic process, nonsense-mediated decay. Is an ortholog of C. elegans smg-3. In C. elegans, smg-3 is involved in nuclear-transcribed mRNA catabolic process, nonsense-mediated decay.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG05463a.1	CBG05463a.1		[unknown]
Transcript:CBG05463b.1	CBG05463b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG05463a	CBG05463a		[unknown]
CDS:CBG05463b	CBG05463b		[unknown]

0 RNAi Result

8 Allele

• WBVar00044284
• WBVar00044279
• WBVar00044294
• WBVar00044289
• WBVar00110620
• WBVar00110618
• WBVar00110619
• WBVar00015344

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1050545
• Remark: Cbr-smg-3, TGCGTCTGATGGTTCCCAAGGATCTTTACAAAGAATCAGAGCAGCGGACGCTTAGCAAAG, WBGene00027908
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term