WormMine: Gene WBGene00028127

• WormBase Gene ID: WBGene00028127
• Gene Name: Cbr-jnk-1
• Sequence Name: CBG05733
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity and MAP kinase activity. Is an ortholog of C. elegans jnk-1. In C. elegans, jnk-1 is involved in several processes, including determination of adult lifespan; negative regulation of cellular response to manganese ion; and response to stress.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG05733b.1	CBG05733b.1		[unknown]
Transcript:CBG05733a.1	CBG05733a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG05733b	CBG05733b		[unknown]
CDS:CBG05733a	CBG05733a		[unknown]

0 RNAi Result

3 Allele

• WBVar00136437
• WBVar00136439
• WBVar00136438

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1052736
• Remark: Cbr-jnk-1, AATATGGATGTAGAACAAAACGTGGATTCGTGGAGAGAGCACATCTTCAGAGAGCTGACT, WBGene00028127
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term