WormMine: Gene WBGene00028141

• WormBase Gene ID: WBGene00028141
• Gene Name: Cbr-adah-1
• Sequence Name: CBG05749
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable deaminase activity. Is an ortholog of C. elegans adah-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG05749b.1	CBG05749b.1		[unknown]
Transcript:CBG05749a.1	CBG05749a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG05749b	CBG05749b		[unknown]
CDS:CBG05749a	CBG05749a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1061188
• Remark: CBG05749, TGAATTGACTCTGGCTCACAAGCAAGTTGGATTGACTATTCACCAACTTTGGAAAGCTGT, WBGene00028141
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term