WormMine: Gene WBGene00028263

• WormBase Gene ID: WBGene00028263
• Gene Name: Cbr-pam-1
• Sequence Name: CBG05905
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable metallopeptidase activity and zinc ion binding activity. Predicted to be involved in proteolysis. Is an ortholog of C. elegans pam-1. In C. elegans, pam-1 is involved in several processes, including exit from meiosis; first cell cycle pseudocleavage; and regulation of reproductive process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG05905b.1	CBG05905b.1		[unknown]
Transcript:CBG05905a.1	CBG05905a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG05905a	CBG05905a		[unknown]
CDS:CBG05905b	CBG05905b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	C.briggsae proteins that showed significantly decreased at L1 larva stage than in emrbyo.	Benjamin and Hochberg corrected p-value < 0.05.	WBPaper00051425:CB_L1_vs_embryo_downregulated
	C.briggsae proteins that showed significantly decreased at L4 larva stage than in emrbyo.	Benjamin and Hochberg corrected p-value < 0.05.	WBPaper00051425:CB_L4_vs_embryo_downregulated

1 Expression Patterns

• Primary Identifier: Expr1068477
• Remark: Cbr-pam-1, CCGTCTTCTCGAATCCAATCGCTCAGTGATCGAGACTCTTCTCAAACAAAGCAACTTATA, WBGene00028263
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term