WormMine: Gene WBGene00028310

• WormBase Gene ID: WBGene00028310
• Gene Name: Cbr-pyk-2
• Sequence Name: CBG05956
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable magnesium ion binding activity; potassium ion binding activity; and pyruvate kinase activity. Predicted to be involved in glycolytic process. Is an ortholog of C. elegans pyk-2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG05956a.1	CBG05956a.1		[unknown]
Transcript:CBG05956b.1	CBG05956b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG05956a	CBG05956a		[unknown]
CDS:CBG05956b	CBG05956b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1061873
• Remark: CBG05956, GATGTGGAAGAGCGTGTTCAATACGGAGTGAATTTGGGAAAGACTCGCGGATTCATTCAT, WBGene00028310
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term