WormMine: Gene WBGene00028376

• WormBase Gene ID: WBGene00028376
• Gene Name: Cbr-adk-1
• Sequence Name: CBG06032
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable adenosine kinase activity. Predicted to be involved in purine ribonucleoside salvage. Is an ortholog of C. elegans adk-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG06032b.1	CBG06032b.1		[unknown]
Transcript:CBG06032a.1	CBG06032a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG06032a	CBG06032a		[unknown]
CDS:CBG06032b	CBG06032b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly decreased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_downregulated
	C.briggsae proteins that showed significantly increased at L4 larva stage than in emrbyo.	Benjamin and Hochberg corrected p-value < 0.05.	WBPaper00051425:CB_L4_vs_embryo_upregulated

1 Expression Patterns

• Primary Identifier: Expr1063163
• Remark: CBG06032, GAAAGGGAATCGAGGCTTCCGTTGCTTGCGGGTCCTATGCAGCTCAAGAAATTATCAAGA, WBGene00028376
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term