WormMine: Gene WBGene00028452

• WormBase Gene ID: WBGene00028452
• Gene Name: Cbr-srgp-1
• Sequence Name: CBG06126
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in signal transduction. Is an ortholog of C. elegans srgp-1. In C. elegans, srgp-1 is involved in negative regulation of cell migration; negative regulation of phagocytosis, engulfment; and regulation of cell-cell adhesion.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG06126a.1	CBG06126a.1		[unknown]
Transcript:CBG06126b.1	CBG06126b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG06126b	CBG06126b		[unknown]
CDS:CBG06126a	CBG06126a		[unknown]

0 RNAi Result

5 Allele

• WBVar00006222
• WBVar00111271
• WBVar00111272
• WBVar00111270
• WBVar00111273

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1060282
• Remark: Cbr-srgp-1, AATCGCCCACTCTGGATGATATTCTGAATTCATTGAAAGTTGCAACCAGTATCAGTCCAT, WBGene00028452
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term