WormMine: Gene WBGene00028571

• WormBase Gene ID: WBGene00028571
• Gene Name: Cbr-ltah-1.1
• Sequence Name: CBG06268
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable metallopeptidase activity and zinc ion binding activity. Predicted to be involved in proteolysis. Is an ortholog of C. elegans ltah-1.1. In C. elegans, ltah-1.1 is involved in peptide catabolic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG06268.1	CBG06268.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG06268	CBG06268		[unknown]

0 RNAi Result

1 Allele

• WBVar00006502

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1066033
• Remark: CBG06268, TTGATGCAAGTCTAGCTTTTGCTCTGGCCGTTGGAAGAATGAAATATTGCAAGCCGATCT, WBGene00028571
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term