WormMine: Gene WBGene00028840

• WormBase Gene ID: WBGene00028840
• Gene Name: Cbr-oac-32
• Sequence Name: CBG06590
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable acyltransferase activity, transferring groups other than amino-acyl groups. Is an ortholog of C. elegans oac-32.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG06590.1	CBG06590.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG06590	CBG06590		[unknown]

0 RNAi Result

2 Allele

• WBVar00005469
• WBVar00005464

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
Heat shock: 34C 30min.	Transcripts that showed significantly increased expression in L2 larva stage C. briggsae animals after incubated in a 34C water bath for 30min.	DESeq2 v 1.18.1, fold change > 2, FDR < 0.01.	WBPaper00058955:heatshock_upregulated_CBG
Virus infection: Santeuil infected at L3 larva stage for 12 hours.	Transcripts that showed signicantly increased expression after Santeuil virus infection to C. briggsae strain JU1264.	edgeR, FDR < 0.05.	WBPaper00051137:Santeuil-virus_upregulated_JU1264

1 Expression Patterns

• Primary Identifier: Expr1056382
• Remark: CBG06590, TATATTGTGCATTGGATGGTTTTGTTCTACTACTTGAATGTTGGAGGAACTCTTCATTAT, WBGene00028840
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term