WormMine: Gene WBGene00028996

• WormBase Gene ID: WBGene00028996
• Gene Name: Cbr-natc-2
• Sequence Name: CBG06776
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable acyltransferase activity, transferring groups other than amino-acyl groups. Is an ortholog of C. elegans natc-2. In C. elegans, natc-2 is involved in dauer larval development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG06776b.1	CBG06776b.1		[unknown]
Transcript:CBG06776a.1	CBG06776a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG06776b	CBG06776b		[unknown]
CDS:CBG06776a	CBG06776a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1065839
• Remark: CBG06776, TGCTCTGGATGCTATGAAATCGAAGGGATGTGACGAAATTGTACTCGAAACAGAAGTGTC, WBGene00028996
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term