WormMine: Gene WBGene00029030

• WormBase Gene ID: WBGene00029030
• Gene Name: Cbr-nac-2
• Sequence Name: CBG06819
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable transmembrane transporter activity. Predicted to be involved in transmembrane transport. Predicted to be located in membrane. Is an ortholog of C. elegans nac-2. In C. elegans, nac-2 is involved in several processes, including carboxylic acid transport; determination of adult lifespan; and regulation of growth.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG06819.1	CBG06819.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG06819	CBG06819		[unknown]

0 RNAi Result

11 Allele

• WBVar00136545
• WBVar00136544
• WBVar00136547
• WBVar00136546
• WBVar00136549
• WBVar00136548
• WBVar00136550
• WBVar00136541
• WBVar00136540
• WBVar00136543
• WBVar00136542

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1055983
• Remark: Cbr-nac-2, TTGCTCATTTGCATTCATGCTTCCGATTTCAACACCACCAAATGCGATTGTATATGATAC, WBGene00029030
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term