WormMine: Gene WBGene00029202

• WormBase Gene ID: WBGene00029202
• Gene Name: Cbr-pqn-85
• Sequence Name: CBG07027
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable chromatin binding activity. Predicted to be involved in mitotic cohesin loading and regulation of gene expression. Is an ortholog of C. elegans scc-2. In C. elegans, scc-2 is involved in several processes, including chromosome organization; double-strand break repair involved in meiotic recombination; and regulation of cell cycle process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG07027a.1	CBG07027a.1		[unknown]
Transcript:CBG07027c.1	CBG07027c.1		[unknown]
Transcript:CBG07027b.1	CBG07027b.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG07027a	CBG07027a		[unknown]
CDS:CBG07027b	CBG07027b		[unknown]
CDS:CBG07027c	CBG07027c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1052516
• Remark: Cbr-pqn-85, TTCCCGAGAAAACACATGATGGAATGGCAGTGCTTTCTGGACTATATCAAAGTCTTCGAA, WBGene00029202
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term